The VIDYANKER team has thoughtfully prepared the NCERT Solutions for Class 12 Biology Chapter 6, "MOLECULAR BASIS OF INHERITANCE" These solutions are designed to help you tackle the NCERT textbook questions with ease. We recommend going through the chapter's theory before diving into the solutions for a deeper understanding. Feel free to share these NCERT Solutions for Class 12 Biology with others—learning is always better when shared!
QUESTIONS FROM TEXTBOOK SOLVED
1. Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine.
Ans: Nitrogenous Bases – Adenine, Uracil and Cytosine, Thymine; Nucleosides – Cytidine, guanosine.
2. If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.
Ans: In a DNA molecule, the number of cytosine molecule is equal to guanine molecules & the number of adenine molecules are equal to thymine molecules. As a result, if a double stranded DNA has 20% of cytosine, it has 20% of guanine. The remaining 60% includes both adenine & thymine which are in equal amounts. So, the percentage of adenine is 30%.
3. If the sequence of one strand of DNA is written as follows:
5′ – ATGCATGCATGCATGCATGCATGCATGC – 3′
Write down the sequence of complementary strand in 5′ —> 3′ direction.
Ans: If the sequence of one strand of DNA is written as follows:
5′ – ATGCATGCATGCATGCATGCATGCATGC – 3′
The sequence of the complementary strand in 5′ —> 3′ direction will be:
5′ – GCATGCATGCATGCATGCATGCATGCAT – 3′
4. If the sequence of the coding strand in a transcription unit is written as follows: 5-ATGCATGCATGCATGCATGCA TGCATGC-3′
Write down the sequence of mRNA.
Ans: mRNA: 5′ -A U G CAU G CAU G C AU G CA UGCAUGCAUGC-3′.
5. Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain
Ans: The antiparallel, double-stranded nature of the DNA molecule led Watson and Crick to hypothesise semi-conservative mode of DNA replication. They suggested that the two strands of DNA molecule uncoil and separate, and each strand serves as a template for the synthesis of a new (complementary) strand alongside it. The template and its complement, then form a new DNA double strand, identical to the original DNA molecule. The sequence of bases which should be present in the new strands can be easily predicted because these would be complementary to the bases present in the old strands. A will pair with T, T with A, C with G, and G with C. Thus, two daughter DNA molecules identical to the parent molecule are formed and each daughter DNA molecule consists of one old (parent) strand and one new strand. Since only one parent strand is conserved in each daughter molecule, this mode of replication is said to be semiconservative. Meselson and Stahl and Joseph Taylor, later proved it by experiments.
6. Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesized from it (DNA or RNA), list the types of nucleic acid polymerases.
Ans: (i) DNA dependent DNA polymerase – synthesis.
(ii) DNA dependent RNA polymerase – synthesis.
(iii) RNA dependent DNA polymerase – Retroviral nucleic acid.
(iv) RNA dependent RNA polymerase – cDNA synthesis.
7. How did Hershey and Chase differentiate between DNA and protein in their experiment white proving that DNA is the genetic material?
Ans: Alfred Hershey and Martha Chase chose the bacteriophages, which are viruses specific to the bacteria. In 1952, they chose the T2 bacteriophage as their experimental material.
They grew some viruses in a medium containing radioactive phosphorus (p32) and others on medium containing radioactive sulphur (s35). The viruses cultured in the medium of radioactive phosphorus contain the radioactive DNA but the protein is non-radioactive as DNA contains phosphorus while protem does not. Similarly, the viruses cultured on radioactive sulphur contain radioactive protein but not radio'active DNA because DNA does not contain sulphur.
The radioactive phages were permitted to attach onto E. coli bacteria. Then, during the progression of the infection, the viral coats were rubbed off from the bacteria in a blender. The particles of the virus were separated from the bacteria through a centrifuge.
Bacteria which was infected with viruses that had radioactive DNA were radioactive, meaning that it was DNA that passed from the virus to the bacteria. Bacteria that were infected with viruses that had radioactive proteins were not radioactive. This means that proteins did not enter the bacteria from the viruses. DNA is, therefore, the genetic material that is transferred from the virus to the bacteria.
8. Differentiate between the followings:
(a) Repetitive DNA and Satellite DNA
(b) mRNAand tRNA
(c) Template strand and Coding strand
Ans: (a) Repetitive DNA and satellite DNA
Repetitive DNA | Satellite DNA | |
1. | Repetitive DNA are DNA sequences that contain small segments, which are repeated many times. | Satellite DNA are DNA sequences that contain highly repetitive DNA. |
(b) mRNA and tRNA
mRNA | tRNA | |
1. | mRNA or messenger RNA acts as a template for the process of transcription. | tRNA or transfer RNA acts as an adaptor molecule that carries a specific amino acid to mRNA for the synthesis of polypeptide. |
2. | It is a linear molecule. | It has clover leaf shape. |
(c) Template strand and coding strand
Template strand | Coding strand | |
1. | Template strand of DNA acts as a template for the synthesis of mRNA during transcription. | Coding strand is a sequence of DNA that has the same base sequence as that of mRNA (except thymine that is replaced by uracil in DNA). |
2. | It runs from 3’ to 5’. | It runs from 5’to 3’. |
9. List two essential roles of ribosome during translation.
Ans: Two essential roles of ribiosomes during translation are ;o
(i) they provide surface for binding of mRNA in the groove of smaller sub unit of ribosome.
(ii) As larger sub unit of ribosome has peptidy transferase on its ‘P’ site, therefore, it helps in joining amino acids by forming peptide bonds. .
10. In the medium where E. coli was growing, lactose was added, which induced the lac operon. Then why does lac operon shut down some time after addition of lactose in the medium?
Ans: Lac operon is switched on, on adding lactose in medium, as lactose acts as inducer and makes repressor inactive by binding with it. When the lac operon system is switched on, β-galactosidase is formed, which converts lactose into glucose and galactose. As soon as all the lactose is consumed, repressor again becomes active and causes the system to switch off (shut down).
11. Explain (in one or two lines) the function of the followings:
(a) Promoter
(b) tRNA
(c) Exons
Ans: Promoter: It is one of the three components of a transcription unit that takes part in transcription. It is located at the start 5′ end and provides site for attachment of transcription factors (TATA Box) and RNA polymerase. tRNA: It takes part in the transfer of activated amino acids from cellular pool to ribosome for their taking part in protein formation.
Exons: In eukarytoes, DNA is mosaic of exons and introns. Exons are coding sequences of DNA which are transcribed and translated both.
12. Why is the Human genome project called a mega project?
Ans: Human genome project is called a mega project because
(i) it required bioinformatics data basing and other high speed computational devices for analysis, storage and retrieval of information.
(ii) it generated lot of information in the form of sequence annotation.
(iii) it was carried out in number of labs and coordinated on extensive scale.
13. What is DNA fingerprinting? Mention its application.
Ans: DNA fingerprinting or DNA typing is a technique of determining nucleotide sequences of certain areas (VNTRs) of DNA which are unique to each individual. Each person has a unique DNA fingerprint. Unlike a conventional fingerprint that occurs only on the fingertips and can be altered by surgery, a DNA fingerprint is the same for every cell, tissue and organ of a person. It cannot be changed by any known treatment. Applications of DNA fingerprinting are as follows:
Paternity disputes can be solved by DNA fingerprinting.
DNA fingerprinting technique is being used to identify genes connected with hereditary diseases.
It is useful in detection of crime and legal pursuits.
It can identify racial groups, their origin, historical migrations and invasions.
14. Briefly describe the following:
(a) Transcription
(b) Polymorphism
(c) Translation
(d) Bioinformatics
Ans: Transcription : It is DNA directed synthesis of RNA in which the RNA is transcribed on 3*—>5’ template strand of DNA in 5’—>3’ direction. Polymorphism: Variation at genetic level arisen due,to mutation, is called polymorphism. Such variations are unique at particular site of DNA, forming satellite DNA. The polymorphism in DNA sequences is the basis of genetic mapping and DNA finger printing.
Translation : Protein synthesis from mRNA, tRNA, rRNA.
Bioinformatics : Computational method of handling and analyzing biological databases.
